Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 3. CLASP2 Is Required for Neural Progenitor Differentiation and Controls Terminal Division of Neural Progenitor Cells (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immuno- staining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 mm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2. (B–G) Mouse embryos were electroporated in utero with GFP-tagged scrambled control (B) or CLASP2 shRNAs (C) at E14.5. The pregnant dams were injected intraperitoneally with EdU 24 hr following electroporation and embryos were analyzed at E16.5. Coronal brain sections immunostained for EdU (red) and Ki67 (blue) showed an increased in the percentage of electroporated cells that were positive for Edu (D) and Ki67 (E) located in the VZ (bin area 1, within the first 20 mm) in CLASP2 knockdown cells. There was no effect of CLASP2 shRNA on the total number of EdU-positive cells (F); however, there was a significant decrease in the number of EdU-positive/Ki67-negative cells exiting the cell cycle (G). Arrowheads for (B) represents GFP-positive cells, which is EdU-positive/Ki67-negative in

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: In Utero, Control, shRNA, Immunostaining, Marker, Knockdown, Injection, Electroporation

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 4. CLASP2 Is Necessary for Radial Migration of Cortical Projection Neurons in the Mammalian Brain (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains), and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoechst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ, ventricular zone; SVZ, subventricular zone; IZ, intermediate zone; CP, cortical plate; loCL, lower cortical layer; upCL, upper cortical layer; WM, white matter). For additional data, see Figure S3. (D) Coronal brain sections from E14.5 CLASP2 shRNA electropo- ration and analyzed at P14 were immunostained with layers II/III marker CDP (red). (E and F) Representative images of morphological defects of CLASP2 shRNA neurons in the upCL and loCL. CLASP2 knockdown caused an increase in the number of primary neurites independent of cortical layer (control, n = 53 cells; CLASP2 shRNA upCL, n = 60 cells; CLASP2 shRNA loCL, n = 39 cells were analyzed). For addi- tional data, see Figure S4. Data are means ± SEM and statistical significance was assessed using one-way ANOVA (*p < 0.05, **p < 0.001, ***p < 0.0001). Scale bar represents 50 mm (A–D) and 10 mm (E).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Migration, In Utero, Control, shRNA, Transfection, Marker, Knockdown

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 5. CLASP2 Is Required for Neuronal Polarity Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at P0. (A) Morphological and quantitative analysis of migrating GFP- positive neurons showing the length of the leading process (control, n = 44 cells; CLASP2 shRNA, n = 34 cells). (B and C) Representative images of the angle of the leading proess in relation to the pial surface. The angle was measured by using the closest connecting line from the cell soma to the pia (control, n = 20 cells; CLASP2 shRNA, n = 23 cells). The percentage of cells with a leading process oriented between 0–10, 11–90, and 91–180 to the pia were quantitated. (D) Immunohistochemical analysis of ascending radial glial fibers immunostained against Nestin (red) showed normal stereotypi- cal radial fibers spanning the entire cortical wall in control and CLASP2 shRNA cortex, oriented from the VZ toward the pial surface (VZ, ventricular zone; SVZ, subventricular zone; IZ, in- termediate zone; CP, cortical plate). Data are means ± SEM (A–C) and statistical significance was assessed using unpaired t test (***p < 0.0001). Scale bar rep- resents 10 mm (A and C), 20 mm (B), and 25 and 50 mm for (D).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: In Utero, Control, shRNA, Immunohistochemical staining

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 6. CLASP2 Is Necessary for Centrosome-Golgi Localization (A and B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Immunostaining, Knockdown, Control, shRNA, Staining

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 8. GSK3b Phosphorylation of CLASP2 Regulates Cell Motility and Neurite Extension (A) Table lists several CLASP2 phosphopeptides identified by tandem mass spectrometry showing changes following Reelin treatment of mouse primary neurons. The first two columns indicate the start and end position of the peptides within the mouse CLASP2g sequence. The amino acid sequence is indicated with the putative phos- phorylation site (marked in red) followed by the position of the residue within CLASP2g. Ascore represents the probability of correct phosphory- lation site localization based on the presence and intensity of site-determining ions from the MS/MS spectra. H/L represents the ratio of signal of the specific phosphopeptide in Reelin (H) or control (L) treated neurons. For additional data, see Figures S6 and S7. (B) Representative images of primary dissociated mouse wild-type neuron cultures co-infected with scrambled control, CLASP2 shRNAs or CLASP2 shRNAs with CLASP2-wild-type (WT), CLASP2- 9S/A, or -8S/D phospho mutants and immuno- stained against tau axonal marker at 2 days in vitro. (C) CLASP2 shRNA caused a decrease in axon length when compared to control. Both CLASP2- WT and phospho-resistant CLASP2-9S/A rescued the CLASP2 shRNA phenotype, whereas phos- pho-mimetic CLASP2-8S/D was unable to rescue the axonal effects of CLASP2 knockdown (control, n = 19; CLASP2 shRNA, n = 28; CLASP2-WT, n = 21; CLASP2-9S/A, n = 17; CLASP2-8S/D, n = 33 cells). (D) Primary mouse wild-type neuron cultures were co-infected with scrambled control, CLASP2 shRNAs or CLASP2 shRNAs with CLASP2-wild- type (WT), CLASP2-9S/A, or -8S/D phospho mutants and cell migration was assessed by measuring the area of migration away from the initial aggregates over a 48 hr period. (E) CLASP2 shRNA caused a decrease in migration area compared to control (control, n = 8; CLASP2 shRNA, n = 8 aggregates). (F and G) Phospho-mimetic CLASP2-8S/D was unable to rescue the deleterious effects of CLASP2 shRNA on cell motility compared to CLASP2 WT and CLASP2-9S/A phosphomutant (control, n = 8; CLASP2 shRNA, n = 8; CLASP2- WT, n = 5; CLASP2-9S/A, n = 9; CLASP2-8S/D, n = 13 aggregates). Data are means ± SEM and statistical significance was assessed using one-way ANOVA (*p < 0.05). Scale bar represents 10 mm (B) and 50 mm (D).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Phospho-proteomics, Mass Spectrometry, Sequencing, Residue, Tandem Mass Spectroscopy, Control, Infection, Staining, Marker, In Vitro, shRNA, Knockdown, Migration